pCA528-CHMP1A
(Plasmid
#254686)
-
PurposeExpresses His-SUMO-CHMP1A (with a Ulp1 cleavage site) in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254686 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCA528
- Total vector size (bp) 6179
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCHMP1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)588
-
Entrez GeneCHMP1A (a.k.a. CHMP1, PCH8, PCOLN3, PRSM1, VPS46-1, VPS46A)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-SUMO tag (followed by a Ulp1 cleavage site) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GATGGAAGCGTTCGCTAAAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCA528-CHMP1A was a gift from Wesley Sundquist (Addgene plasmid # 254686 ; http://n2t.net/addgene:254686 ; RRID:Addgene_254686) -
For your References section:
Phosphatidylinositol diphosphate binding by ESCRT-III filaments. Alian A, McCullough J, Moss FR 3rd, Talledge N, Mohammed A, Gerstner CD, Dalluge JA, Paine EL, Davulcu O, Chang CL, Frost A, Sundquist WI. Proc Natl Acad Sci U S A. 2026 Jul 7;123(27):e2616668123. doi: 10.1073/pnas.2616668123. Epub 2026 Jun 30. 10.1073/pnas.2616668123 PubMed 42378278