Skip to main content

pCA528-CHMP1A
(Plasmid #254686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254686 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCA528
  • Total vector size (bp) 6179
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CHMP1A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    588
  • Entrez Gene
    CHMP1A (a.k.a. CHMP1, PCH8, PCOLN3, PRSM1, VPS46-1, VPS46A)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-SUMO tag (followed by a Ulp1 cleavage site) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GATGGAAGCGTTCGCTAAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA528-CHMP1A was a gift from Wesley Sundquist (Addgene plasmid # 254686 ; http://n2t.net/addgene:254686 ; RRID:Addgene_254686)
  • For your References section:

    Phosphatidylinositol diphosphate binding by ESCRT-III filaments. Alian A, McCullough J, Moss FR 3rd, Talledge N, Mohammed A, Gerstner CD, Dalluge JA, Paine EL, Davulcu O, Chang CL, Frost A, Sundquist WI. Proc Natl Acad Sci U S A. 2026 Jul 7;123(27):e2616668123. doi: 10.1073/pnas.2616668123. Epub 2026 Jun 30. 10.1073/pnas.2616668123 PubMed 42378278