pTP3-AAV-RBFOX3enhancer-mCherry
(Plasmid
#254715)
-
PurposeThis AAV vector contains an enhancer that drives mCherry expression in spinal cord skeletal motor neurons of alpha subtype. Specificity of vector not characterized outside the mouse spinal cord.
-
Depositing Lab
-
Depositing OrganizationRutgers, The State University of New Jersey
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAV from Addgene Plasmid #37825
-
Backbone manufacturerEdward Boyden (Addgene plasmid # 37825)
- Total vector size (bp) 5770
-
Vector typeMammalian Expression, Mouse Targeting, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRBFOX3 enhancer, mini promoter, synthetic intron, mCherry, WPRE
-
SpeciesM. musculus (mouse), Synthetic
-
Entrez GeneRbfox3 (a.k.a. Fox-3, Hrnbp3, NeuN, Neuna60)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gattaacccgccatgctactt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTP3-AAV-RBFOX3enhancer-mCherry was a gift from Tulsi Patel (Addgene plasmid # 254715 ; http://n2t.net/addgene:254715 ; RRID:Addgene_254715) -
For your References section:
From Wiring to Firing: Collapse of embryonic identities and emergence of functional diversity during motor neuron maturation. Chen Y, Chi HM, Tian A, Miller A, Patel T. bioRxiv [Preprint]. 2025 Nov 22:2025.08.12.669897. doi: 10.1101/2025.08.12.669897. 10.1101/2025.08.12.669897 PubMed 40832264