Tol2-LyzC-GFP-pa-u6ac-Vamp8-guides
(Plasmid
#254764)
-
PurposeVamp8 gRNA for neutrophil specific KO in tol2 backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneTol2-lyzc
-
Vector typeCRISPR ; Zebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVamp8
-
gRNA/shRNA sequenceCCCAGAAGGTCGCTCGTGC, CGGGCCAGAATTCGATCAAC
-
SpeciesD. rerio (zebrafish)
-
Entrez Genevamp8 (a.k.a. wu:fa18d07, zgc:56588)
- Promoter Lyzc
Cloning Information
- Cloning method Gateway Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.05.08.652481 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-LyzC-GFP-pa-u6ac-Vamp8-guides was a gift from Qing Deng (Addgene plasmid # 254764 ; http://n2t.net/addgene:254764 ; RRID:Addgene_254764) -
For your References section:
RABEP1 regulates neutrophil migration via endosomal recycling and actin polymerization. Kim DH, Syahirah R, Zheng C, Ding C, Hsu AY, Pikes T, Liang Z, Liu S, Li L, Bao X, Umulis D, Wan J, Deng Q. J Leukoc Biol. 2026 Feb 9;118(2):qiaf174. doi: 10.1093/jleuko/qiaf174. 10.1093/jleuko/qiaf174 PubMed 41701563