pLKO-Rabep1 shRNA 369958-CMV-TurboGFP
(Plasmid
#254777)
-
PurposeRabep1 shRNA 369958 in pLKO backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA 369958
-
gRNA/shRNA sequenceGGTTAAAGAACTGAATCATTACTCGAGTAATGATTCAGTTCTTTAACC
-
SpeciesH. sapiens (human)
-
Entrez GeneRABEP1 (a.k.a. RAB5EP, RABPT5)
- Promoter CMV
Cloning Information
- Cloning method Other
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMISSION TRC2 pLKO.5-puro RABEP1 shRNA 3 Plasmid DNA (TRCN0000369958)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Infusion Cloning. Please visit https://doi.org/10.1101/2025.05.08.652481 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-Rabep1 shRNA 369958-CMV-TurboGFP was a gift from Qing Deng (Addgene plasmid # 254777 ; http://n2t.net/addgene:254777 ; RRID:Addgene_254777) -
For your References section:
RABEP1 regulates neutrophil migration via endosomal recycling and actin polymerization. Kim DH, Syahirah R, Zheng C, Ding C, Hsu AY, Pikes T, Liang Z, Liu S, Li L, Bao X, Umulis D, Wan J, Deng Q. J Leukoc Biol. 2026 Feb 9;118(2):qiaf174. doi: 10.1093/jleuko/qiaf174. 10.1093/jleuko/qiaf174 PubMed 41701563