Skip to main content

pLKO-Rabep1 shRNA 369958-CMV-FL Rabep1
(Plasmid #254779)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254779 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLKO
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA 369958 and Rabep1
  • gRNA/shRNA sequence
    GGTTAAAGAACTGAATCATTACTCGAGTAATGATTCAGTTCTTTAACC
  • Species
    H. sapiens (human)
  • Entrez Gene
    RABEP1 (a.k.a. RAB5EP, RABPT5)
  • Promoter CMV

Cloning Information

  • Cloning method Other

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    MISSION TRC2 pLKO.5-puro RABEP1 shRNA 3 Plasmid DNA (TRCN0000369958)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Infusion Cloning. Please visit https://doi.org/10.1101/2025.05.08.652481 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-Rabep1 shRNA 369958-CMV-FL Rabep1 was a gift from Qing Deng (Addgene plasmid # 254779 ; http://n2t.net/addgene:254779 ; RRID:Addgene_254779)
  • For your References section:

    RABEP1 regulates neutrophil migration via endosomal recycling and actin polymerization. Kim DH, Syahirah R, Zheng C, Ding C, Hsu AY, Pikes T, Liang Z, Liu S, Li L, Bao X, Umulis D, Wan J, Deng Q. J Leukoc Biol. 2026 Feb 9;118(2):qiaf174. doi: 10.1093/jleuko/qiaf174. 10.1093/jleuko/qiaf174 PubMed 41701563