Skip to main content

E. coli BW25113:PcpcG2-tetR (CMB247)
(Bacterial strain #254898)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 254898 Bacteria in agar stab 1 $94

Backbone

  • Vector backbone
    n/a

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BW25113:PcpcG2-tetR (CMB247)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Carries a single chromosomal copy of the repressor TetR downstream of PcpcG2 promoter inserted in nupG locus

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For validation, use primers: FWD: CGTGAGCGGTAAAGTTGTTG and REV: CGGAGCTGCAAGGTGTTTATAG flanking the nupG locus to verify gene insertion.

Please visit https://doi.org/10.1101/2024.11.27.625634 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E. coli BW25113:PcpcG2-tetR (CMB247) was a gift from Mary Dunlop (Addgene plasmid # 254898)
  • For your References section:

    Dynamic heterogeneity in an E. coli stress response regulon mediates gene activation and antimicrobial peptide tolerance. Blassick CM, Moghimianavval H, Jafarbeglou F, Lugagne JB, Dunlop MJ. Cell Rep. 2026 Apr 16;45(4):117259. doi: 10.1016/j.celrep.2026.117259. 10.1016/j.celrep.2026.117259 PubMed 41996246