pFastBac1_F734Y-hDPP9_6His
(Plasmid
#254905)
-
PurposepFastBac1 vector for the recombinant overexpression in insect cells of the human DPP9 protein mutated at position 734.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFastBac1
- Backbone size w/o insert (bp) 4683
- Total vector size (bp) 7299
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Gentamicin, 100 & 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDipeptidyl peptidase 9
-
Alt nameDPP9
-
Alt nameDPRP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2614
-
MutationChanged Phenylalanine 734 to Tyrosine.
-
GenBank IDNM_139159.5
-
Entrez GeneDPP9 (a.k.a. DP9, DPLP9, DPP IX, DPRP-2, DPRP2, HATIS, IMD111)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 6His-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TTTGTTCGCCCAGGACTCTAGC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid was originally syntesised by GenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac1_F734Y-hDPP9_6His was a gift from Ingrid De Meester (Addgene plasmid # 254905 ; http://n2t.net/addgene:254905 ; RRID:Addgene_254905) -
For your References section:
An Interdisciplinary Approach Provides Insights into the Pronounced Selectivity of Compound 42 for DPP9. Beyens O, Corthaut S, Lambeir AM, Van Der Veken P, Sterckx YG, De Meester I, De Winter H. ChemMedChem. 2025 Mar 3;20(5):e202400700. doi: 10.1002/cmdc.202400700. Epub 2024 Nov 27. 10.1002/cmdc.202400700 PubMed 39552560