px459-sgPNPLA3
(Plasmid
#255036)
-
PurposeUsed to generate PLNPLA3 knockout; targets Exon 3
-
Depositing Lab
-
Depositing OrganizationMedical University of South Carolina
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRISPR Cas9 guide for PNPLA3 exon 3
-
gRNA/shRNA sequenceTGGTATGTTCCTGCTTCATC
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459-sgPNPLA3 was a gift from Stephen Duncan (Addgene plasmid # 255036 ; http://n2t.net/addgene:255036 ; RRID:Addgene_255036) -
For your References section:
A PNPLA3-Deficient iPSC-Derived Hepatocyte Screen Identifies Pathways to Potentially Reduce Steatosis in Metabolic Dysfunction-Associated Fatty Liver Disease. Doueiry C, Kappler CS, Martinez-Morant C, Duncan SA. Int J Mol Sci. 2024 Jul 2;25(13):7277. doi: 10.3390/ijms25137277. 10.3390/ijms25137277 PubMed 39000384