Skip to main content
Addgene
Open Menu

ASWT_pET-28a(+)
(Plasmid #255044)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 255044 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pET-28a(+)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Wild Type alpha-synuclein (aa 1-140) (Accession No.NM_000345.3)
  • Species
    H. sapiens (human)
  • Mutation
    WT
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

WT: DNA sequences coding for human a-synuclein sequence (Accession No. NM_000345.3) amino acid residues 1-140 (wildtype) were amplified and ligated into the pET24 vector with an N-terminal His-tag (EMD Biosciences) and sequences were confirmed. The a-synuclein K23Q mutation was engineered using Q5 Site-Directed Mutagenesis (NEB) using the primers CCACACCCTGTTGGGTTTTCTCAG and CAGAAGCAGCAGGAAAGAC. The plasmids were transformed into BL21(DE3) E. coli (EMD Biosciences).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ASWT_pET-28a(+) was a gift from Byron Caughey (Addgene plasmid # 255044 ; http://n2t.net/addgene:255044 ; RRID:Addgene_255044)

  • For your References section:

    Rapid and ultra-sensitive quantitation of disease-associated alpha-synuclein seeds in brain and cerebrospinal fluid by alphaSyn RT-QuIC. Groveman BR, Orru CD, Hughson AG, Raymond LD, Zanusso G, Ghetti B, Campbell KJ, Safar J, Galasko D, Caughey B. Acta Neuropathol Commun. 2018 Feb 9;6(1):7. doi: 10.1186/s40478-018-0508-2. 10.1186/s40478-018-0508-2 PubMed 29422107
Related items: