Golgi-TagBFP-T7-BspQI
(Plasmid
#255259)
-
PurposeIn-vitro transcription template for TagBFP reporter labelling Golgi bodies
-
Depositing Lab
-
Depositing OrganizationKyoto University, Center for iPS Cell Research and Application
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255259 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIVT-BspQI
-
Backbone manufacturerTakara Bio
-
Vector typeIn-vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGTS mTagBFP
-
SpeciesH. sapiens (human)
- Promoter T7
-
Tag
/ Fusion Protein
- BFGT1 (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Golgi-TagBFP sequence was obtained from Imre Berger via Addgene (Plasmid #206259).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Golgi-TagBFP-T7-BspQI was a gift from Knut Woltjen (Addgene plasmid # 255259 ; http://n2t.net/addgene:255259 ; RRID:Addgene_255259) -
For your References section:
Messenger RNA-encoded reporters for monitoring cellular stress and bioenergetics. Hwang KK, Fang Q, Nizard C, Bulteau AL, Woltjen K. Sci Rep. 2026 Jun 17;16(1):18698. doi: 10.1038/s41598-026-49851-y. 10.1038/s41598-026-49851-y PubMed 42310021