mtKeima-T7-BspQI
(Plasmid
#255260)
-
PurposeIn-vitro transcription template for mitochondrially localized mtKeima
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIVT-BspQI
-
Backbone manufacturerTakara Bio
-
Vector typeIn-vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemt-mKeima
-
Speciesstony coral Montipora
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe mt-mKeima sequence was obtained from Richard Youle via Addgene (Plasmid #131626).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mtKeima-T7-BspQI was a gift from Knut Woltjen (Addgene plasmid # 255260 ; http://n2t.net/addgene:255260 ; RRID:Addgene_255260) -
For your References section:
Messenger RNA-encoded reporters for monitoring cellular stress and bioenergetics. Hwang KK, Fang Q, Nizard C, Bulteau AL, Woltjen K. Sci Rep. 2026 Jun 17;16(1):18698. doi: 10.1038/s41598-026-49851-y. 10.1038/s41598-026-49851-y PubMed 42310021