MPT7 CD
(Plasmid #255265)

• Purpose: eMutaT7 with optimized pmCDA1
• Depositing Lab: Jumi Shin
• Publication: Ali et al Nucleic Acids Res. 2025 Jul 19;53(14):gkaf746. doi: 10.1093/nar/gkaf746.

Backbone

• Vector backbone: pBAD33
• Backbone manufacturer: Seokhee Kim
• Backbone size w/o insert (bp): 8327
• Total vector size (bp): 9091
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: cytidine deaminase (fused to T7RNA Polymerase)
• Alt name: pmCDA1
• Species: Synthetic
• Insert Size (bp): 627
• Promoter: arabinose
• Tag / Fusion Protein:
  • T7RNA Polymerase (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCAATTGTCCATATTGCATCAG

Gene/Insert 2

• Gene/Insert name: UGI
• Insert Size (bp): 252
• Promoter: Arabinose

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: cctccgtgacatcttagagtc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Restriction sites were introduced by us via SDM and cloning was performed by us. Codon-optimized pmCDA1 was obtained from pSEVA221T7RNAP (Addgene#167974).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Backbone: doi: 10.1093/nar/gkaa1231
Insert: doi: 10.1038/s41467-020-20230-z.