MPT7 CD
(Plasmid
#255265)
-
PurposeeMutaT7 with optimized pmCDA1
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255265 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBAD33
-
Backbone manufacturerSeokhee Kim
- Backbone size w/o insert (bp) 8327
- Total vector size (bp) 9091
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namecytidine deaminase (fused to T7RNA Polymerase)
-
Alt namepmCDA1
-
SpeciesSynthetic
-
Insert Size (bp)627
- Promoter arabinose
-
Tag
/ Fusion Protein
- T7RNA Polymerase (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCAATTGTCCATATTGCATCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameUGI
-
Insert Size (bp)252
- Promoter Arabinose
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer cctccgtgacatcttagagtc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRestriction sites were introduced by us via SDM and cloning was performed by us. Codon-optimized pmCDA1 was obtained from pSEVA221T7RNAP (Addgene#167974).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Backbone: doi: 10.1093/nar/gkaa1231
Insert: doi: 10.1038/s41467-020-20230-z.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MPT7 CD was a gift from Jumi Shin (Addgene plasmid # 255265 ; http://n2t.net/addgene:255265 ; RRID:Addgene_255265) -
For your References section:
Unlocking genetic potential: harnessing phage for targeted mutagenesis in phage-assisted evolution. Ali M, Khan A, Nursimulu TV, Shin JA. Nucleic Acids Res. 2025 Jul 19;53(14):gkaf746. doi: 10.1093/nar/gkaf746. 10.1093/nar/gkaf746 PubMed 40794866