pET28a-6xHis-SSF1
(Plasmid
#255298)
-
PurposeSSF1 (1-473) with an N-terminal 6X poly-histidine tag and a TEV recognition site sub-cloned into pET28 plasmids with Kanamycin bacterial resistance, were used for protein expression
-
Depositing Lab
-
Depositing OrganizationSt. Jude Children's Research Hospital
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSSF1
-
SpeciesH. sapiens (human)
-
Entrez GenePPAN (a.k.a. BXDC3, SSF, SSF-1, SSF1, SSF2)
- Promoter T7
-
Tag
/ Fusion Protein
- 6x-His (N terminal on backbone)
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATGGGCCAGAGTGGCCGCAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.03.01.640913 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-6xHis-SSF1 was a gift from Richard Kriwacki (Addgene plasmid # 255298 ; http://n2t.net/addgene:255298 ; RRID:Addgene_255298) -
For your References section:
Granular component sub-phases direct ribosome biogenesis in the nucleolus. Dogra P, Ferrolino MC, Khatun S, Tolbert M, Miao Q, Pruett-Miller SM, Pitre A, Tripathi S, Campbell GE, Bajpai R, Freyaldenhoven T, Gibbs E, Park C-G, Kriwacki RW. bioRxiv 2025.03.01.640913 10.1101/2025.03.01.640913