DrReDawn2
(Plasmid
#255329)
-
Purpose(Empty Backbone) DrReDawn2 plasmid for stringent control of bacterial gene expression by red light
-
Depositing Lab
-
Depositing OrganizationUniversitaet Bayreuth
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneDrReDawn2
- Backbone size (bp) 8837
-
Vector typeBacterial Expression
-
Tags
/ Fusion Proteins
- His6 (N terminal on backbone)
- thrombin site (N terminal on backbone)
- His6 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DrReDawn2 was a gift from Andreas Moeglich (Addgene plasmid # 255329 ; http://n2t.net/addgene:255329 ; RRID:Addgene_255329)