CHAC1-promoter-WT-GFP
(Plasmid
#255523)
-
PurposeTo determine CHAC1 promoter activity
-
Depositing Lab
-
Depositing OrganizationAugusta University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3598
-
Modifications to backboneIn the vector pEGFP-N1, partial f1 single-strand DNA origin was removed by SspI digestion followed by self-ligation. In addition, the CMV promoter was removed by AseI and NheI digestion, followed by Klenow fragment filling and self-ligation. The modified pEGFP-N1 vector contains no f1 and CMV promoter.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHAC1 promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)589
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TTTGCTCACATGTTCTTTCCTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sequence inserted at EcoRI (5') and BamHI (3') sites, both preserved after cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CHAC1-promoter-WT-GFP was a gift from Xingguo Zhu (Addgene plasmid # 255523 ; http://n2t.net/addgene:255523 ; RRID:Addgene_255523)