pYS108
(Plasmid
#255530)
-
PurposeBacterial expression of W163(5HTP) variant of human γS-crystallin
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Irvine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28a(+)
- Total vector size (bp) 5815
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameW163(5HTP) variant of human γS-crystallin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)590
-
MutationTryptophan 163 changed to 5-hydroxytryptophan
-
Entrez GeneCRYGS (a.k.a. CRYG8, CTRCT20)
- Promoter T7
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYS108 was a gift from Rachel Martin (Addgene plasmid # 255530 ; http://n2t.net/addgene:255530 ; RRID:Addgene_255530) -
For your References section:
Mimicking oxidative damage in gammaS-crystallin with site-specific incorporation of 5-hydroxytryptophan. Seo Y, Long ZG, Demerdjian TK, Avenido AA, Butts CT, Martin RW. Biophys Rep (N Y). 2026 Mar 11;6(1):100251. doi: 10.1016/j.bpr.2026.100251. Epub 2026 Jan 16. 10.1016/j.bpr.2026.100251 PubMed 41548873