pTU1-B_J23100_arr-3
(Plasmid
#255534)
-
PurposeExpresses arr-3 in cell-free
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTU1-B
- Total vector size (bp) 3071
-
Modifications to backboneTwo SNPs in pTU1-B backbone ORI, annotated in sequence.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namearr-3
-
SpeciesKlebsiella pneumoniae
-
GenBank IDAJ277027.1
- Promoter J23100
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GCGGCCGCTTCTAGAACGTCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU1-B_J23100_arr-3 was a gift from Simon Moore (Addgene plasmid # 255534 ; http://n2t.net/addgene:255534 ; RRID:Addgene_255534) -
For your References section:
A liquid handling platform for standardised quantification of cell-free enzymatic activity encoded by antimicrobial resistance genes. Bergum M, Suthakaran S, Martin B, Sutton JM, Moore SJ. Synthetic Biology, 2026;, ysag010, doi: 10.1093/synbio/ysag010 10.1093/synbio/ysag010