CAG-loxp-stop-loxp-IL17RA-QY-tTA-T2A-IL17RC-TEV-IRES-TagBFP-PA
(Plasmid
#255643)
-
PurposeExpress mouse IL-17A CyCLoPs cassette followed by TagBFP as a marker
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGEM3Z
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameIL-17RA
-
SpeciesM. musculus (mouse)
-
Entrez GeneIl17ra (a.k.a. Cdw217, Il17r, VDw217)
- Promoter CAG
-
Tag
/ Fusion Protein
- tTA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gene Synthesis
- 5′ sequencing primer AGTCGCTCTGAGTTGTTATCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIL-17RC
-
SpeciesM. musculus (mouse)
-
Entrez GeneIl17rc (a.k.a. 1110025H02Rik, Gm19850, IL-17RC, IL17-RC, IL17-RL, Il17rl)
-
Tag
/ Fusion Protein
- TEV (C terminal on insert)
Gene/Insert 3
-
Gene/Insert nameTagBFP
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-loxp-stop-loxp-IL17RA-QY-tTA-T2A-IL17RC-TEV-IRES-TagBFP-PA was a gift from Jun Huh (Addgene plasmid # 255643 ; http://n2t.net/addgene:255643 ; RRID:Addgene_255643) -
For your References section:
In vivo detection of immune responses via cytokine activity labeling. Lu G, Zhang S, Feng M, Kim E, Cho D, Kim JH, Caris H, Silberstein L, Choi GB, Huh JR. Cell. 2026 Feb 5;189(3):939-955.e26. doi: 10.1016/j.cell.2025.12.011. Epub 2026 Jan 7. 10.1016/j.cell.2025.12.011 PubMed 41506266