pAAV-gfaABC1D-Lyn_11-Erex-mKate2-b PAC F198Y
(Plasmid #255733)

• Purpose: Astrocytic expression of PACmn with mKate2, a membrane targeted version of the photoactivatable adenylyl cyclase from Beggiatoa with lowered dark activity.
• Depositing Lab: Thomas Oertner
• Depositing Organization: Universitaetsklinikum Hamburg-Eppendorf
  Located in Germany
• Publication: Differential roles of astrocytes and microglia in shaping ATP release events (unpublished) (unpublished)

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5152
• Total vector size (bp): 6920
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2xLyn-ERex-mKate2-bPAC(F198Y)
• Alt name: PACmn
• Species: H. sapiens (human), Synthetic; Aequoria victoria/Beggiatoa
• Insert Size (bp): 1768
• Promoter: gfaABC1D
• Tags / Fusion Proteins:
  • Lyn11 (GCIKSKGKDS) (N terminal on insert)
  • ER exit ( FCYENE) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TTGCCTTTCTCTCCACAGGT
• 3′ sequencing primer: GGCATTAAAGCAGCGTATCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The promoter is from pZac2.1 gfaABC1D-cyto-GCaMP6f (Addgene Plasmid #52925), a gift from Baljit Khakh.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry