pAAV-gfaABC1D-Crimson CAAX-NES IRES Cre
(Plasmid
#255734)
-
PurposeAstrocytic expression of Cre recombinase and Red Fluorescent Protein (Crimson) for labelling fine structures in astrocytes
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Hamburg-Eppendorf
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255734 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCrimson CAAX
-
Insert Size (bp)799
- Promoter gfaABC1D Addgene Plasmid #52925
-
Tag
/ Fusion Protein
- CAAX (C terminal on insert) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SgsI (not destroyed)
- 5′ sequencing primer TTGCCTTTCTCTCCACAGGT
- 3′ sequencing primer GCGGCTTCGGCCAGTAACG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameIRES Cre
-
SpeciesSynthetic
-
Insert Size (bp)1630
- Promoter gfaABC1D Addgene Plasmid #52925
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SgsI (AscI) (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTGCCTTTCTCTCCACAGGT
- 3′ sequencing primer GTTGATTATCGATAAGCTTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from a plasmid made by Michael Lin (pCDNA3.1-caggs-Crimson-CAAX ,Addgene Plasmid #190041), Karl Deisseroth (pAAV-Ef1a-mCherry-IRES-Cre, Addgene Plasmid # 55632), and Baljit Khakh (pZac2.1 gfaABC1D-cyto-GCaMP6f, Addgene Plasmid #52925).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-gfaABC1D-Crimson CAAX-NES IRES Cre was a gift from Thomas Oertner (Addgene plasmid # 255734 ; http://n2t.net/addgene:255734 ; RRID:Addgene_255734)