pCI-Syn-LSSmOrange
(Plasmid
#255757)
-
PurposeLong-Stokes-Shift mOrange expressing in neuronal cells as a structural marker
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Hamburg-Eppendorf
Located in Germany -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255757 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3780
- Total vector size (bp) 4501
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLSSmOrange
-
SpeciesSynthetic
-
Insert Size (bp)721
-
MutationA44V/F84L/W145M/I165D/M167L/G202D compared to mOrange (but numbering relative to EGFP)
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTCGTGAGGCACTGGGCAG
- 3′ sequencing primer GTCCAAACTCATCAATGTATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from pBAD-LSSmOrange (Addgene plasmid #37129), a gift from Vladislav Verkusha.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.04.09.717511 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-Syn-LSSmOrange was a gift from Thomas Oertner (Addgene plasmid # 255757 ; http://n2t.net/addgene:255757 ; RRID:Addgene_255757) -
For your References section:
Dissecting the molecular triggers of early and late long-term potentiation. Wang R, Schweizer M, Ponimaskine K, Schulze C, Gee CE, Oertner TG. bioRxiv 2026.04.09.717511 10.64898/2026.04.09.717511