pCAHS1
(Plasmid
#255769)
-
PurposePlasmid for expression of tardigrade PrCAHS1 for generation of cell-free expression lysate, and protein purification using heat solubility
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJUMP26, p15a, KanR
- Backbone size w/o insert (bp) 2421
- Total vector size (bp) 3111
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePrCAHS1
-
Alt nameP0CU51 (UniProt ID)
-
Alt nameCAHS 107838
-
Alt nameCAHS1_PARRC
-
SpeciesParamacrobiotus richtersi
-
Insert Size (bp)690
- Promoter T7max
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gactgagcctttcgtttta
- 3′ sequencing primer cattactggatctatcaacagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.03.29.715078 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAHS1 was a gift from Henrike Niederholtmeyer (Addgene plasmid # 255769 ; http://n2t.net/addgene:255769 ; RRID:Addgene_255769) -
For your References section:
Tardigrade-Derived Strategy for Low-Cost Storage of Cell-Free Expression Lysates. Meckelburg M, Banlaki I, Gaizauskaite A, Niederholtmeyer H. bioRxiv 2026.03.29.715078; doi: 10.64898/2026.03.29.715078 10.64898/2026.03.29.715078