PspCas13b gB2M in pRDA221 no Puro
(Plasmid
#255842)
-
PurposegB2M in pRDA221
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRDA221 no Puro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB2M
-
gRNA/shRNA sequenceGGATGGATGAAACCCAGACACATAGCAATT
-
SpeciesH. sapiens (human)
-
Entrez GeneB2M (a.k.a. AMYLD6, IMD43, MHC1D4)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PspCas13b gB2M in pRDA221 no Puro was a gift from Sefi Rosenbluh (Addgene plasmid # 255842 ; http://n2t.net/addgene:255842 ; RRID:Addgene_255842)