Skip to main content

sgPABPC1 in PspCas13b-NES-lentiCRISPRv2-PuroR
(Plasmid #255851)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 255851 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    PspCas13b-NES lentiCRISPRv2 Puro
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PABPC1
  • gRNA/shRNA sequence
    TCTGCATATACTGGTTAGTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    PABPC1 (a.k.a. PAB1, PABP, PABP1, PABPC2, PABPL1)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgPABPC1 in PspCas13b-NES-lentiCRISPRv2-PuroR was a gift from Sefi Rosenbluh (Addgene plasmid # 255851 ; http://n2t.net/addgene:255851 ; RRID:Addgene_255851)
  • For your References section:

    DUSP11 is an RNA triphosphatase that limits PspCas13b activity by destabilizing gRNA abundance in mammalian cells. Purcell J, Liu L, Calvert RW, Hayes BK, Huang C, Davidovich C, Knott GJ, Rosenbluh J. Nucleic Acids Res. 2026 Apr 23;54(8):gkag412. doi: 10.1093/nar/gkag412. 10.1093/nar/gkag412 PubMed 42080266