sgTAF4 in PspCas13b-NES-lentiCRISPRv2-PuroR
(Plasmid
#255853)
-
PurposesgTAF4 (Cas9) and PspCa13b-NES expression
-
Depositing Lab
-
Depositing OrganizationMonash University
Located in Australia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePspCas13b-NES lentiCRISPRv2 Puro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTAF4
-
gRNA/shRNA sequenceGACCGAGCTACTCAGCACCA
-
SpeciesH. sapiens (human)
-
Entrez GeneTAF4 (a.k.a. MRD73, TAF(II)130, TAF(II)135, TAF2C, TAF2C1, TAF4A, TAFII-130, TAFII-135, TAFII130, TAFII135)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgTAF4 in PspCas13b-NES-lentiCRISPRv2-PuroR was a gift from Sefi Rosenbluh (Addgene plasmid # 255853 ; http://n2t.net/addgene:255853 ; RRID:Addgene_255853) -
For your References section:
DUSP11 is an RNA triphosphatase that limits PspCas13b activity by destabilizing gRNA abundance in mammalian cells. Purcell J, Liu L, Calvert RW, Hayes BK, Huang C, Davidovich C, Knott GJ, Rosenbluh J. Nucleic Acids Res. 2026 Apr 23;54(8):gkag412. doi: 10.1093/nar/gkag412. 10.1093/nar/gkag412 PubMed 42080266