N-mCherry-TMEM230
(Plasmid
#255856)
-
PurposeExpression of human TMEM230 (isoform 1), codon optimised, in mammalian cells. N-terminally tagged with mCherry
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5329
- Total vector size (bp) 6536
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMEM230
-
SpeciesH. sapiens (human)
-
Insert Size (bp)360
-
Entrez GeneTMEM230 (a.k.a. C20orf30, HSPC274, dJ1116H23.2.1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- N-mCherry with 3C cleavage site (N terminal on insert)
- Flag-tag (N terminal on backbone)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGene TMEM230 was codon-optimised for human expression and de novo synthesised by GENEWIZ from Azenta Life Science.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N-mCherry-TMEM230 was a gift from Joseph Lyons (Addgene plasmid # 255856 ; http://n2t.net/addgene:255856 ; RRID:Addgene_255856) -
For your References section:
Fluorescence-Gated Flow Cytometry Approach for Measuring Lipid Flippase Activity in Mammalian Cells. Scholtissek KT, Van den Haute C, Pamula FK, Lyons JA. J Membrane Biol 259, 32 (2026) 10.1007/s00232-026-00392-5