N-BFP-TMEM230
(Plasmid
#255858)
-
PurposeExpression of human TMEM230 (isoform 1), codon optimised, in mammalian cells, N-terminally tagged with monomeric blue fluorescent protein
-
Depositing Lab
-
Depositing OrganizationAarhus University
Located in Denmark -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5342
- Total vector size (bp) 6527
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTMEM230
-
SpeciesH. sapiens (human)
-
Insert Size (bp)360
-
Entrez GeneTMEM230 (a.k.a. C20orf30, HSPC274, dJ1116H23.2.1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- N-BFP with 3C cleavage site (N terminal on insert)
- Flag-tag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence of monomeric BFP was a gift from Vladislav Verkhusha, but its sequence is published (Subach et al., 2008; doi: 10.1016/j.chembiol.2008.08.006; PMID: 18940671). Gene TMEM230 was codon-optimised for human expression and de novo synthesised by GENEWIZ from Azenta Life Science.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the depositor's annotated reference file has minor differences compared to the Addgene verified sequence (P39 in codon optimized TMEM230). The depositor confirms that this change is not known to affect plasmid function. Please refer to the the Addgene sequence for the most accurate result.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N-BFP-TMEM230 was a gift from Joseph Lyons (Addgene plasmid # 255858 ; http://n2t.net/addgene:255858 ; RRID:Addgene_255858) -
For your References section:
Fluorescence-Gated Flow Cytometry Approach for Measuring Lipid Flippase Activity in Mammalian Cells. Scholtissek KT, Van den Haute C, Pamula FK, Lyons JA. J Membrane Biol 259, 32 (2026) 10.1007/s00232-026-00392-5