N-BFP-TMEM230
(Plasmid #255858)

• Purpose: Expression of human TMEM230 (isoform 1), codon optimised, in mammalian cells, N-terminally tagged with monomeric blue fluorescent protein
• Depositing Lab: Joseph Lyons
• Publication: Scholtissek et al J Membrane Biol 259, 32 (2026)

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5342
• Total vector size (bp): 6527
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TMEM230
• Species: H. sapiens (human)
• Insert Size (bp): 360
• Entrez Gene: TMEM230 (a.k.a. C20orf30, HSPC274, dJ1116H23.2.1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • N-BFP with 3C cleavage site (N terminal on insert)
  • Flag-tag (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The sequence of monomeric BFP was a gift from Vladislav Verkhusha, but its sequence is published (Subach et al., 2008; doi: 10.1016/j.chembiol.2008.08.006; PMID: 18940671). Gene TMEM230 was codon-optimised for human expression and de novo synthesised by GENEWIZ from Azenta Life Science.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the depositor's annotated reference file has minor differences compared to the Addgene verified sequence (P39 in codon optimized TMEM230). The depositor confirms that this change is not known to affect plasmid function. Please refer to the the Addgene sequence for the most accurate result.