C-BFP-VAMP3
(Plasmid #255860)

• Purpose: Expression of human VAMP3, in mammalian cells, N-terminally tagged with monomeric blue fluorescent protein
• Depositing Lab: Joseph Lyons
• Publication: Scholtissek et al J Membrane Biol 259, 32 (2026)

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5349
• Total vector size (bp): 6447
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VAMP3
• Species: H. sapiens (human)
• Insert Size (bp): 300
• Entrez Gene: VAMP3 (a.k.a. CEB)
• Promoter: CMV
• Tags / Fusion Proteins:
  • monomeric BFP with 3C cleavage site (C terminal on insert)
  • Flag-tag (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The sequence of VAMP3 was a gift from Thierry Galli and originates from Addgene plasmid #42310. The sequence of monomeric BFP was a gift from Vladislav Verkhusha, but its sequence is published (Subach et al., 2008; doi: 10.1016/j.chembiol.2008.08.006; PMID: 18940671).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry