C-BFP-VAMP3
(Plasmid
#255860)
-
PurposeExpression of human VAMP3, in mammalian cells, N-terminally tagged with monomeric blue fluorescent protein
-
Depositing Lab
-
Depositing OrganizationAarhus University
Located in Denmark -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5349
- Total vector size (bp) 6447
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVAMP3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)300
-
Entrez GeneVAMP3 (a.k.a. CEB)
- Promoter CMV
-
Tags
/ Fusion Proteins
- monomeric BFP with 3C cleavage site (C terminal on insert)
- Flag-tag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe sequence of VAMP3 was a gift from Thierry Galli and originates from Addgene plasmid #42310. The sequence of monomeric BFP was a gift from Vladislav Verkhusha, but its sequence is published (Subach et al., 2008; doi: 10.1016/j.chembiol.2008.08.006; PMID: 18940671).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C-BFP-VAMP3 was a gift from Joseph Lyons (Addgene plasmid # 255860 ; http://n2t.net/addgene:255860 ; RRID:Addgene_255860) -
For your References section:
Fluorescence-Gated Flow Cytometry Approach for Measuring Lipid Flippase Activity in Mammalian Cells. Scholtissek KT, Van den Haute C, Pamula FK, Lyons JA. J Membrane Biol 259, 32 (2026) 10.1007/s00232-026-00392-5