Skip to main content
Addgene
Open Menu

pAAV CAG Nuc-flox(mCherry)-EGFP
(Plasmid #256094)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 256094 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pOTTC1032
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CAG (EF1a promoter in the backbone was replaced by CAG promoter)
  • Promoter CAG
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cgttacataacttacggtaaat
  • 3′ sequencing primer WPRE R1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV CAG Nuc-flox(mCherry)-EGFP was a gift from Baoji Xu (Addgene plasmid # 256094 ; http://n2t.net/addgene:256094 ; RRID:Addgene_256094)

  • For your References section:

    Genetic Dissection of BDNF and TrkB Expression in Glial Cells. Niu C, Yue X, An JJ, Bass R, Xu H, Xu B. Biomolecules. 2024 Jan 11;14(1):91. doi: 10.3390/biom14010091. 10.3390/biom14010091 PubMed 38254691
Related items: