pZE21-blaCOR-1
(Plasmid
#256721)
-
PurposepZE21 derivative expressing the COR-1 metallo-β-lactamase
-
Depositing Lab
-
Depositing OrganizationHellenic Pasteur Institute
Located in Greece -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepZE21-MCS
-
Backbone manufacturerEXPRESSYS
- Backbone size w/o insert (bp) 2254
- Total vector size (bp) 768
-
Modifications to backbonenone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameblaCOR-1
-
SpeciesCorallococcus sp. 4LFB
-
Insert Size (bp)768
-
Mutationnone
-
GenBank IDPQ855795
- Promoter pTetO/L
-
Tag
/ Fusion Protein
- none (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TGGCAATTCCGACGTCTAAG
- 3′ sequencing primer GTCTAGGGCGGCGGATTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZE21-blaCOR-1 was a gift from Stathis Kotsakis (Addgene plasmid # 256721 ; http://n2t.net/addgene:256721 ; RRID:Addgene_256721) -
For your References section:
Predatory myxobacteria lay at the cross-roads of metallo-beta-lactamase evolution. Lambropoulou A, Pavlidi A, Samiotaki M, Tammam MA, Ioannou E, Roussis V, Tzouvelekis LS, Miriagou V, Kotsakis SD. Commun Biol. 2026 Jun 12. doi: 10.1038/s42003-026-10466-8. 10.1038/s42003-026-10466-8 PubMed 42286160