Skip to main content

OlexA_mini35S_Cas9
(Plasmid #257235)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 257235 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTSKO-based vector
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    EPI300
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OlexA_mini35S_Cas9
  • Species
    Streptococcus pyogenes (Cas9)
  • Promoter OlexA_mini35S
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer acggataaaccttttcacgccc
  • 3′ sequencing primer cattttcgtatgcgatcttgtact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TSKO backbone from PMID: 31562216

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    OlexA_mini35S_Cas9 was a gift from On Sun Lau (Addgene plasmid # 257235 ; http://n2t.net/addgene:257235 ; RRID:Addgene_257235)
  • For your References section:

    Stomatal XVE: an inducible system for cell-stage-specific gene expression and editing in the stomatal lineage. Kou S, Chua LC, Tan JQ, Lau OS. New Phytol. 2026 Apr;250(2):1330-1347. doi: 10.1111/nph.71017. Epub 2026 Feb 15. 10.1111/nph.71017 PubMed 41693245