OlexA_mini35S_Cas9
(Plasmid
#257235)
-
PurposeA cloning backbone with mCherry tagged Cas9 designed for single-guide RNA insertion and inducible knockout
-
Depositing Lab
-
Depositing OrganizationNational University of Singapore
Located in Singapore -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257235 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTSKO-based vector
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOlexA_mini35S_Cas9
-
SpeciesStreptococcus pyogenes (Cas9)
- Promoter OlexA_mini35S
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer acggataaaccttttcacgccc
- 3′ sequencing primer cattttcgtatgcgatcttgtact
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TSKO backbone from PMID: 31562216
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OlexA_mini35S_Cas9 was a gift from On Sun Lau (Addgene plasmid # 257235 ; http://n2t.net/addgene:257235 ; RRID:Addgene_257235) -
For your References section:
Stomatal XVE: an inducible system for cell-stage-specific gene expression and editing in the stomatal lineage. Kou S, Chua LC, Tan JQ, Lau OS. New Phytol. 2026 Apr;250(2):1330-1347. doi: 10.1111/nph.71017. Epub 2026 Feb 15. 10.1111/nph.71017 PubMed 41693245