NK814
(Plasmid
#257339)
-
PurposeExpresses the fluorescent membrane marker GG(PTSG_00306)::mStayGold under S. rosetta Actin promoter with internal Puromycin resistance cassette driven by EFL promoter.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneNK802
- Backbone size w/o insert (bp) 5586
- Total vector size (bp) 6269
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGeranyl_geranylation_PTSG00306-mStayGold
-
Alt nameGG-mStayGold
-
SpeciesSalpingoeca rosetta
-
Insert Size (bp)690
-
Mutationno
-
GenBank IDEGD72285.1
-
Tag
/ Fusion Protein
- mStayGold (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTACGTTTGGCATTTTCC
- 3′ sequencing primer CAATCAAGAAAGAGAGAGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NK814 was a gift from Nicole King (Addgene plasmid # 257339 ; http://n2t.net/addgene:257339 ; RRID:Addgene_257339) -
For your References section:
An adhesion GPCR regulates cell adhesion and mating in the closest living relatives of metazoans. De Las Bayonas AG, Gonzalez S, King N. bioRxiv 2026.06.27.734982 10.64898/2026.06.27.734982