NK816
(Plasmid #257341)

• Purpose: Encodes the 3’ end of S. rosetta PTSG_03655 CDS (without STOP codon) fused to a linker and followed by mStayGold CDS and the 3’ UTR region of S. rosetta PTSG_03655.
• Depositing Lab: Nicole King
• Publication: bioRxiv--An adhesion GPCR mediates mating in the closest living relatives of animals (unpublished)

Backbone

• Vector backbone: pMS18
• Backbone size w/o insert (bp): 4570
• Total vector size (bp): 5911
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PTSG_03655_3'CDS-recovery-sequence-linker-mStayGold-PTSG_03655-3’UTR
• Alt name: PTSG_03655-mStayGold
• Species: Salpingoeca rosetta
• Insert Size (bp): 1341
• Mutation: Synonymous codon mutations made to PTSG_03655 3' CDS region (described in publication and on the map of the plasmid provided)
• GenBank ID: XP_004995383.1
• Tag / Fusion Protein:
  • mStayGold (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACCATGATTACGCCAAGCTT
• 3′ sequencing primer: AACAAGACTGCAGTCGTTACG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry