NK816
(Plasmid
#257341)
-
PurposeEncodes the 3’ end of S. rosetta PTSG_03655 CDS (without STOP codon) fused to a linker and followed by mStayGold CDS and the 3’ UTR region of S. rosetta PTSG_03655.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMS18
- Backbone size w/o insert (bp) 4570
- Total vector size (bp) 5911
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePTSG_03655_3'CDS-recovery-sequence-linker-mStayGold-PTSG_03655-3’UTR
-
Alt namePTSG_03655-mStayGold
-
SpeciesSalpingoeca rosetta
-
Insert Size (bp)1341
-
MutationSynonymous codon mutations made to PTSG_03655 3' CDS region (described in publication and on the map of the plasmid provided)
-
GenBank IDXP_004995383.1
-
Tag
/ Fusion Protein
- mStayGold (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCATGATTACGCCAAGCTT
- 3′ sequencing primer AACAAGACTGCAGTCGTTACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NK816 was a gift from Nicole King (Addgene plasmid # 257341 ; http://n2t.net/addgene:257341 ; RRID:Addgene_257341) -
For your References section:
An adhesion GPCR regulates cell adhesion and mating in the closest living relatives of metazoans. De Las Bayonas AG, Gonzalez S, King N. bioRxiv 2026.06.27.734982 10.64898/2026.06.27.734982