PssaG-sfGFP(LVA)
(Plasmid
#257839)
-
PurposeTranscriptional reporter for SPI-2 (PssaG-sfGFP(LVA))
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTU1-a-SC101-carb
-
Backbone manufacturermodified from EcoFlex library
- Backbone size w/o insert (bp) 3845
- Total vector size (bp) 4958
-
Vector typeBacterial Expression ; Golden Gate (EcoFlex)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePssaG-BBa_B0034-sfGFP-LVA-L3S2P21
-
SpeciesSalmonella enterica serovar Typhimurium
-
Insert Size (bp)1113
- Promoter PssaG
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CAGTGTGGTGGAATTCTGCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PssaG-sfGFP(LVA) was a gift from Keara Lane (Addgene plasmid # 257839 ; http://n2t.net/addgene:257839 ; RRID:Addgene_257839) -
For your References section:
Temporal tuning of switch-like virulence expression resolves environmental uncertainty through phenotypic heterogeneity. Spratt M., Lane K.. Current Biology, Volume 36, Issue 13, 2026, Pages 3336-3353.e8 ISSN 0960-9822 10.1016/j.cub.2026.06.001