PssaG-sfGFP-mRuby2
(Plasmid
#257840)
-
PurposeTranscriptional reporter for SPI-2 (PssaG-sfGFP - no degradation tag) with constitutive mRuby2
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257840 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTU2-a-pSC101-Kan
-
Backbone manufacturermodified from EcoFlex library
- Backbone size w/o insert (bp) 3712
- Total vector size (bp) 5737
-
Vector typeBacterial Expression ; Golden Gate (EcoFlex)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 20 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePssaG-BBa_B0034-sfGFP-L3S2P21
-
SpeciesSalmonella enterica serovar Typhimurium
-
Insert Size (bp)1074
- Promoter ssaG
Cloning Information for Gene/Insert 1
- Cloning method Golden Gate
- 5′ sequencing primer ccacctgacgtctaagaaacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSJM901-PET3a_RBS-mRuby2-Bba_B0015
-
SpeciesSalmonella enterica serovar Typhimurium
-
Insert Size (bp)912
- Promoter SJM901
Cloning Information for Gene/Insert 2
- Cloning method Golden Gate
- 5′ sequencing primer gtgatggtcctgttctgctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PssaG-sfGFP-mRuby2 was a gift from Keara Lane (Addgene plasmid # 257840 ; http://n2t.net/addgene:257840 ; RRID:Addgene_257840) -
For your References section:
Temporal tuning of switch-like virulence expression resolves environmental uncertainty through phenotypic heterogeneity. Spratt M., Lane K.. Current Biology, Volume 36, Issue 13, 2026, Pages 3336-3353.e8 ISSN 0960-9822 10.1016/j.cub.2026.06.001