pLVX-eGFP-STING-mut-RRDD
(Plasmid
#257889)
-
PurposeLentiviral vector to induce mouse eGFP tagged mutant STING RRDD expression in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVX
- Backbone size w/o insert (bp) 8335
- Total vector size (bp) 9472
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP_ms_STING_mut_RRDD
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1137
-
Mutationchanged Arginine 330 and 333 to Aspartic acid
- Promoter eF1a
-
Tag
/ Fusion Protein
- eGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Mlu1 (not destroyed)
- 5′ sequencing primer GGTTCATTCTCAAGCCTCAG
- 3′ sequencing primer CGAGGTCG ACGGTATCGA TG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-eGFP-STING-mut-RRDD was a gift from Michel Desjardins (Addgene plasmid # 257889 ; http://n2t.net/addgene:257889 ; RRID:Addgene_257889)