UtPEv3-SlHKT1;2 (PE8431)
(Plasmid
#257971)
-
PurposeGolden Gate level 2, replicon- and UtPEv3-based binary vector for installing the desired edit at the SlHKT1;2 locus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLSL.R.Ly
-
Backbone manufacturerJae-Yean Kim Lab
- Backbone size w/o insert (bp) 6791
- Total vector size (bp) 19601
-
Vector typePlant Expression, CRISPR, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUtPEv3
-
gRNA/shRNA sequencepegR-SlHKT1;2
-
SpeciesSynthetic
- Promoter CaMV35S
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer ggcgcgtgccgaattcggat
- 3′ sequencing primer cccactgacttgaagtacac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UtPEv3-SlHKT1;2 (PE8431) was a gift from Jae-Yean Kim (Addgene plasmid # 257971 ; http://n2t.net/addgene:257971 ; RRID:Addgene_257971) -
For your References section:
Development of an ultra-efficient prime editing system in tomato. Van Vu T, Thi Nguyen N, Kim J, Hoai Nguyen T, Kim JY. Nat Commun. 2026 Jan 12;17(1):95. doi: 10.1038/s41467-025-67874-3. 10.1038/s41467-025-67874-3 PubMed 41526382