pCEP4-Fab1F4-Light-chain
(Plasmid
#257995)
-
PurposeExpresses anti-GABAA-alpha1 Fab1F4 light chain in CHO cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCEP4
-
Backbone manufacturerThermo
- Backbone size w/o insert (bp) 10886
- Total vector size (bp) 11654
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameanti-human-GABAA-alpha1 Fab 1F4 light chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)729
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GACGTCAATGGGAGTTTGTTTTG
- 3′ sequencing primer TTTACGGTCTTTAAAAAGGCCGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We purchased the pCEP4 vector from Thermo, and synthesized the insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEP4-Fab1F4-Light-chain was a gift from Ryan Hibbs (Addgene plasmid # 257995 ; http://n2t.net/addgene:257995 ; RRID:Addgene_257995) -
For your References section:
Resolving native GABA(A) receptor structures from the human brain. Zhou J, Noviello CM, Teng J, Moore H, Lega B, Hibbs RE. Nature. 2025 Feb;638(8050):562-568. doi: 10.1038/s41586-024-08454-1. Epub 2025 Jan 22. 10.1038/s41586-024-08454-1 PubMed 39843743