DG003_pLenti_CMV_Kir2.1_mGFP
(Plasmid
#258170)
-
PurposeExpression of an inward-rectifier potassium channel Kir2.1 carrying an mGFP tag
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258170 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameKir2.1_mGFP
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gggtttattacagggacagcagagat
- 3′ sequencing primer tcgataagcttgatatcgaattctcacttgt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.07.17.739178 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DG003_pLenti_CMV_Kir2.1_mGFP was a gift from Adam Cohen (Addgene plasmid # 258170 ; http://n2t.net/addgene:258170 ; RRID:Addgene_258170) -
For your References section:
Absolute voltage mapping using dynamic photocycle control. Gong D, Zhang J, Howell MR, Wu X, Jia BZ, Cohen AE. bioRxiv 2026.07.17.739178 10.64898/2026.07.17.739178