pBJ121_pMTB_Bactin2_Voltron2_KGC_ER2
(Plasmid
#258173)
-
PurposeUbiquitously expresses membrane localized Voltron2 in zebrafish via tol2 transgenesis or in vitro transcription of mRNA
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMTB
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVoltron2_KGC_ER2
-
SpeciesSynthetic
- Promoter Beta Actin 2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTCACATGCTTGCTG
- 3′ sequencing primer GCAATAGCATCACAAATTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.07.17.739178 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ121_pMTB_Bactin2_Voltron2_KGC_ER2 was a gift from Adam Cohen (Addgene plasmid # 258173 ; http://n2t.net/addgene:258173 ; RRID:Addgene_258173) -
For your References section:
Absolute voltage mapping using dynamic photocycle control. Gong D, Zhang J, Howell MR, Wu X, Jia BZ, Cohen AE. bioRxiv 2026.07.17.739178 10.64898/2026.07.17.739178