Skip to main content
Addgene
Open Menu

Xenopus laevis pan-krt59 pGEM-T Easy vector
(Plasmid #258303)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258303 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pGEM-T Easy
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 3015
  • Total vector size (bp) 3697
  • Vector type
    Cloning vector for in vitro transcription and riboprobe generation for in situ hybridization

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pan keratin 59
  • Alt name
    krt59
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    682
  • Entrez Gene
    krt59.S (a.k.a. XELAEV_18016081mg, krt5.3, krt5.3.S)
  • Entrez Gene
    krt59.L (a.k.a. XELAEV_18013623mg, krt5.3, krt5.3.L)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer GGCGAGAAATCACGTCTGG
  • 3′ sequencing primer CCAGTTTCACATTCATCAGTTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A L215 mutation was found in pan keratin 59 which causes a frameshift and extends translation 23 aa's. This discrepancy does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Xenopus laevis pan-krt59 pGEM-T Easy vector was a gift from Leopold Eckhart (Addgene plasmid # 258303 ; http://n2t.net/addgene:258303 ; RRID:Addgene_258303)

  • For your References section:

    Hoxc13 and homologs of mammalian hair keratins are required for the cornification of nuptial pads in Xenopus frogs. Steinbinder J, Sachslehner AP, Golabi B, Carron M, Vleminckx K, Eckhart L. Commun Biol. 2026 Jun 20. doi: 10.1038/s42003-026-10519-y. 10.1038/s42003-026-10519-y PubMed 42323399
Related items: