LentiCrispr V2 Fads2 sgRNA1
(Plasmid
#258338)
-
PurposeCrispr mediated knockout of Fads2 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258338 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCrispr V2
- Total vector size (bp) 13013
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA1 targeting Fads2
-
gRNA/shRNA sequenceGAGGAGCCCAGCCTGGACCG
-
SpeciesM. musculus (mouse)
-
Entrez GeneFads2 (a.k.a. 2900042M13Rik, Fads2a, Fadsd2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hU6_f
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysgRNA sequence was synthesized by IDT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCrispr V2 Fads2 sgRNA1 was a gift from Xiaoai Zhao (Addgene plasmid # 258338 ; http://n2t.net/addgene:258338 ; RRID:Addgene_258338) -
For your References section:
Lipidomic profiling reveals age-dependent changes in plasma membrane lipids that affect neural stem cell aging. Zhao X, Feitzinger RM, Na J, Yan X, Erickson A, Contrepois K, Zhou OY, Vallania F, Ellenberger M, Kashiwagi CM, Gagnon SD, Siebrand CJ, Cabruja M, Traber GM, McKay A, Hornburg D, Khatri P, Snyder MP, Zare RN, Brunet A. Sci Adv. 2026 Jul 31;12(31):eaeh9771. doi: 10.1126/sciadv.aeh9771. Epub 2026 Jul 29. 10.1126/sciadv.aeh9771 PubMed 42525742