Skip to main content

LentiCrispr V2 Agpat3 sgRNA1
(Plasmid #258364)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258364 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    LentiCrispr V2
  • Total vector size (bp) 13013
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgRNA1 targeting Agpat3
  • gRNA/shRNA sequence
    GAAGAGAGTGCACTCCGTGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Agpat3 (a.k.a. D10Jhu12e, lpaat3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer hU6_f
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    sgRNA sequence was synthesized by IDT

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCrispr V2 Agpat3 sgRNA1 was a gift from Xiaoai Zhao (Addgene plasmid # 258364 ; http://n2t.net/addgene:258364 ; RRID:Addgene_258364)
  • For your References section:

    Lipidomic profiling reveals age-dependent changes in plasma membrane lipids that affect neural stem cell aging. Zhao X, Feitzinger RM, Na J, Yan X, Erickson A, Contrepois K, Zhou OY, Vallania F, Ellenberger M, Kashiwagi CM, Gagnon SD, Siebrand CJ, Cabruja M, Traber GM, McKay A, Hornburg D, Khatri P, Snyder MP, Zare RN, Brutel A. Science Advances, Vol 12, Issue 31, 29 Jul 2026 10.1126/sciadv.aeh9771