Skip to main content

plentiCRISPRv2 DLG5
(Plasmid #258468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258468 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    plentiCRISPRv2
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DLG5 sgRNA
  • gRNA/shRNA sequence
    GCTCAAGCTGCTCTTGGCCA
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unspecified (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plentiCRISPRv2 DLG5 was a gift from Matthew Kutys (Addgene plasmid # 258468 ; http://n2t.net/addgene:258468 ; RRID:Addgene_258468)
  • For your References section:

    Scrib organizes cortical actomyosin clusters to maintain adherens junctions and angiogenic sprouting. Mayo LN, Duong F, Mompeon A, Jacobs KA, Iruela-Arispe ML, Kutys ML. J Cell Biol. 2026 Jun 1;225(6):e202503146. doi: 10.1083/jcb.202503146. Epub 2026 Apr 27. 10.1083/jcb.202503146 PubMed 42043432