plentiCRISPRv2 MYO1C
(Plasmid
#258472)
-
PurposeCRISPR-mediated knock-out of human MYO1C
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneplentiCRISPRv2
-
Backbone manufacturerFeng Zhang (Addgene #52961)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYO1C sgRNA
-
gRNA/shRNA sequenceGATCTACAGCCGGCAGCATA
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unspecified (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plentiCRISPRv2 MYO1C was a gift from Matthew Kutys (Addgene plasmid # 258472 ; http://n2t.net/addgene:258472 ; RRID:Addgene_258472) -
For your References section:
Scrib organizes cortical actomyosin clusters to maintain adherens junctions and angiogenic sprouting. Mayo LN, Duong F, Mompeon A, Jacobs KA, Iruela-Arispe ML, Kutys ML. J Cell Biol. 2026 Jun 1;225(6):e202503146. doi: 10.1083/jcb.202503146. Epub 2026 Apr 27. 10.1083/jcb.202503146 PubMed 42043432