Skip to main content

pCC602 - U6-sgAAVS1-EF1a-Cas9-2a-Puro
(Plasmid #258563)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258563 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1sgRNA spacer
  • gRNA/shRNA sequence
    ggggccactagggacaggat

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCC602 - U6-sgAAVS1-EF1a-Cas9-2a-Puro was a gift from Siyuan Zhang (Addgene plasmid # 258563 ; http://n2t.net/addgene:258563 ; RRID:Addgene_258563)
  • For your References section:

    Parallel Activation and Interference CRISPR (PAIR) with Sequencing Uncovers DNA Repair Networks Guiding Precision Cell Engineering. Chang C, Gan D, Diao L, Wang L, Lacelle C, Hon GC, Li J, Zhao M, Zhang S. bioRxiv [Preprint]. 2026 May 8:2026.05.08.722799. doi: 10.64898/2026.05.08.722799. 10.64898/2026.05.08.722799 PubMed 42146330