pCC602 - U6-sgAAVS1-EF1a-Cas9-2a-Puro
(Plasmid
#258563)
-
PurposeU6-driven AAVS1 guide RNA and EF-1α-driven puromycin resistance cassette for PAIR all-in-one AAVS1 knock-in
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAAVS1sgRNA spacer
-
gRNA/shRNA sequenceggggccactagggacaggat
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCC602 - U6-sgAAVS1-EF1a-Cas9-2a-Puro was a gift from Siyuan Zhang (Addgene plasmid # 258563 ; http://n2t.net/addgene:258563 ; RRID:Addgene_258563) -
For your References section:
Parallel Activation and Interference CRISPR (PAIR) with Sequencing Uncovers DNA Repair Networks Guiding Precision Cell Engineering. Chang C, Gan D, Diao L, Wang L, Lacelle C, Hon GC, Li J, Zhao M, Zhang S. bioRxiv [Preprint]. 2026 May 8:2026.05.08.722799. doi: 10.64898/2026.05.08.722799. 10.64898/2026.05.08.722799 PubMed 42146330