Gi2GoA(6)
(Plasmid #258615)

• Purpose: G protein chimera with the core of Gi2 and last six amino acids of GoA
• Depositing Lab: Cesare Orlandi
• Publication: Gαo/z-biased coupling profile of the dopamine D3 receptor (unpublished)

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6500
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: G alpha protein i2
• Species: R. norvegicus (rat)
• Insert Size (bp): 1068
• Mutation: last 6 amino acids of Gi2 swapped with GoA
• GenBank ID: NM_031035
• Entrez Gene: Gnai2 (a.k.a. Galphai2, Hg1c)
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry