Gi2GoA(6)
(Plasmid
#258615)
-
PurposeG protein chimera with the core of Gi2 and last six amino acids of GoA
-
Depositing Lab
-
Depositing OrganizationUniversity of Rochester Medical Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG alpha protein i2
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1068
-
Mutationlast 6 amino acids of Gi2 swapped with GoA
-
GenBank IDNM_031035
-
Entrez GeneGnai2 (a.k.a. Galphai2, Hg1c)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Gi2GoA(6) was a gift from Cesare Orlandi (Addgene plasmid # 258615 ; http://n2t.net/addgene:258615 ; RRID:Addgene_258615)