D2R_D3-ICL3
(Plasmid
#258617)
-
PurposeD2R with ICL3 swapped for D3R ICL3
-
Depositing Lab
-
Depositing OrganizationUniversity of Rochester Medical Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258617 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameD2R
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1426
-
MutationICL2 of D2R swapped for the ICL2 of D3R
-
GenBank ID
-
Entrez GeneDRD2 (a.k.a. D2DR, D2R)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
D2R_D3-ICL3 was a gift from Cesare Orlandi (Addgene plasmid # 258617 ; http://n2t.net/addgene:258617 ; RRID:Addgene_258617)