Skip to main content
Addgene
Open Menu

pPcpxP-gfp
(Plasmid #258832)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258832 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pUA139
  • Backbone manufacturer
    https://www.nature.com/articles/nmeth895
  • Modifications to backbone
    The pPcpxP-gfp reporter plasmid was constructed by amplifying the cpxP promoter region from MG1655 genomic DNA with primers TTTGGATCCCCTTTAATAGGGAAGTCAGC and TTTTCTCGAGGCTTAATGAACTGACTGCCA, restriction with BamHI and XhoI and ligation into vector pUA139 I'm sorry. I am not the one who made this plasmid and I couldn't find plasmid maps. I hope this information is sufficient for you
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Depositor recommends using MG1655 strain for downstream applications.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pPcpxP-gfp
  • Alt name
    the cpxP promoter region from MG1655 genomic DNA
  • Alt name
    Green Fluorescent Protein
  • Species
    E.coli
  • GenBank ID
    U00096
  • Promoter pPcpxP
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer Not described
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPcpxP-gfp was a gift from Matthias Heinemann (Addgene plasmid # 258832 ; http://n2t.net/addgene:258832 ; RRID:Addgene_258832)

  • For your References section:

    Reassessing the role of the Escherichia coli CpxAR system in sensing surface contact. Kimkes TEP, Heinemann M. PLoS One. 2018 Nov 9;13(11):e0207181. doi: 10.1371/journal.pone.0207181. eCollection 2018. 10.1371/journal.pone.0207181 PubMed 30412611
Related items: