pAAV-hSyn-FRed-U6gRsGABAd-a4
(Plasmid
#258849)
-
PurposeGuide RNA (CRISPR-saCas9) for GABRD and GABRA4
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258849 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 2896
- Total vector size (bp) 6304
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
- 3′ sequencing primer CCAGCTTGGTTCCCAATAGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.06.17.732978 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-FRed-U6gRsGABAd-a4 was a gift from D. James Surmeier (Addgene plasmid # 258849 ; http://n2t.net/addgene:258849 ; RRID:Addgene_258849) -
For your References section:
Cholinergic interneuron control of GABAergic circuits targeting spiny projection neurons is disrupted in parkinsonian models. Belal M, Perez-Rosello T, Guven EB, Kocaturk S, Xie Z, Ilijic E, Tkatch T, Li J, Dauer W, Assous M, Tepper JM, Clarke VRJ, Surmeier DJ. bioRxiv 2026.06.17.732978 10.64898/2026.06.17.732978